Learning through art: transcription–from dna to rna

Learning through Art: Flow of Genetic Information through the Cell Using the figure, can you complete the sentences about the structures and processes involved with the flow of information through the cell? Drag the terms on the left to the appropriate blanks on the right to complete the sentences Reset Help transcription The principal role of is to act as a messenger carrying instructions from DNA out of the translation nucleus for the synthesis of proteins. ribosome is the process in which mRNA codons are converted into an amino acid sequence DNA is a long linear polymer found in the nucleus of a cell, shaped like a double helix, and protein associated with the transmission of genetic information RNA serves as the site of protein synthesis in the cytoplasm. is made up of hundreds or thousands of smaller units called amino acids, attached to one another in long chains. is the first step of gene expression, during which a particular segment of DNA is converted into RNA

Answer

The central dogma was first stated by Francis Crick (1958) and then, further was confirmed by other researchers that the biological information flows in a cell in a confined direction It flows from DNA (deoxyribonucleic acid) to RNA (ribonucleic acid) and from RNA to Protein. The process of central dogma is as follows DNA RNA Transcription Translation Replication Protein The adjoined picture below shows the expression of a DNA segment, where the RNA polymerase reads the 3-5 DNA template and synthesizes the 5-3 RNA transcript. Then this 5-3 RNA transcript is translated into a protein with N terminal to C terminal polarity. RNA polymerase Transcription start site Coding strand 5- G Template strand 3- CGACCCAACTGTGGATGAGTITGCCGAATATTACTAACGTCGACTTA...5 GACACCTACTCAAACGGCTTATAATGATTGCAGCTACA...3 -35 Promoter -10 Promoter Transcription consensus sequences RNA 5-AUGAUUGCAGCUACAU-3 Translation NH3*-Met-Ile-Ala-Ala-Thr-COO MIAAT Ribosome is the structure where various RNAs, enzymes, and other molecular species assemble to produce the primary sequence of a protein. It is the place where amino acids are placed in an order specified by the mRNA. For example, the eukaryotic ribosomes are of the 80S (Svedberg) type, containing a large subunit (60s) and a small subunit (40S) These are free cellular organelles and surrounded by only one phospholipid bilayer (cell membrane)

These ribosomes are found in the cytoplasm or associated with the rough endoplasmic reticulum (RER). The smaller subunit of the eukaryotic ribosome (40s subunit) comprises of 18S rRNA (ribosomal ribonucleic acid) and 33 proteins. The 60S (large) subunit contains 5S rRNA, 5.8S rRNA, 28S rRNA and 49 proteins. So, Ribosomal (rRNA) acts as a site and catalytic component of protein synthesis. Therfore, The principal role of RNA is to act as a messenger carrying instructions from DNA out of the nucleus for the synthesis of proteins. translation is the process in which mRNA codons are converted into an amino acid sequence. DNA is a long linear polymer found in the nucleus of a cell, shaped like a double helix, and associated with the transmission of genetic information. ribosome serves as the site of protein synthesis in the cytoplasm. protein is made up of hundreds or thousands of smaller units called amino acids, attached to one another in long chains. transcription is the first step of gene expression, during which a particular segment of DNA is converted into RNA.

Leave a Comment